SMAD1 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

SMAD1 cDNA ORF Clone, Human, N-FLAG tag

SMAD1 cDNA ORF Clone, Human, N-FLAG tag

SPD-13847

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human SMAD family member 1 with N terminal Flag tag.
Target Information
Species Human
Target Name SMAD
Gene Abbr. SMAD1
Gene ID 4086
Full Name SMAD family member 1
Alias BSP-1, BSP1, JV4-1, JV41, MADH1
Introduction Members of the Smad family of signal transduction molecules are components of a critical intracellular pathway that transmit TGF-β signals from the cell surface into the nucleus. Three distinct classes of Smads have been defined: the receptor-regulated Smads (R-Smads), which include Smad1, 2, 3, 5, and 8; the common-mediator Smad (co-Smad), Smad4; and the antagonistic or inhibitory Smads (I-Smads), Smad6 and 7. Activated type I receptors associate with specific R-Smads and phosphorylate them on a conserved carboxy terminal SSXS motif. The phosphorylated R-Smad dissociates from the receptor and forms a heteromeric complex with the co-Smad (Smad4), allowing translocation of the complex to the nucleus. Once in the nucleus, Smads can target a variety of DNA binding proteins to regulate transcriptional responses.Oncogenic Ras antagonizes TGF-beta signaling and inhibits the nuclear accumulation of Smad2 and Smad3, which may be explained through MAP kinase dependent phosphorylation of these Smads.Cell stimulation with EGF leads to phosphorylation of Smad2 at a cluster of serine-proline sites within its linker region, including Ser245, 250, and 255.
Product Details
Description Full length Clone DNA of Human SMAD family member 1 with N terminal Flag tag.
NCBI Ref Seq NM_001003688.1
RefSeq ORF Size 1398 bp
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.