SLC9C1 Knockout Cell Line - CD BioSciences

service-banner

SLC9C1 Knockout Cell Line

SLC9C1 Knockout Cell Line

SPL-03409

Size Price
1 Unit Online Inquiry
Description
22bp deletion
Target Information
Target Name SLC9C1
Gene Abbr. SLC9C1
Gene ID 285335
Full Name solute carrier family 9 member C1
Alias NHE, NHE-10, SLC9A10, sperm-NHE
Species Human
Genomic Locus chr3:112278833
Transcript NM_183061
WT Expression Level 0.07 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of SLC9C1.
Description 22bp deletion
Parental Cell Line C631
Guide RNA Sequence GTATGGCGTTTGCGTATCTT
PCR Primer Forward: ACTCCCATACCCTTTTCTTTCTTCT
Reverse: TCTATCCGTTCTATTCTTCCACACA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.