Online Inquiry
SLC9A7 Knockout Cell Line
SPL-03406
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
1bp deletion |
Target Information | |
---|---|
Target Name | SLC9A7 |
Gene Abbr. | SLC9A7 |
Gene ID | 84679 |
Full Name | solute carrier family 9 member A7 |
Alias | MRX108, NHE-7, NHE7, SLC9A6 |
Species | Human |
Genomic Locus | chrX:46682417 |
Transcript | NM_001257291 |
WT Expression Level | 4.53 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a sodium and potassium/ proton antiporter that is a member of the solute carrier family 9 protein family. The encoded protein is primarily localized to the trans-Golgi network and is involved in maintaining pH homeostasis in organelles along the secretory and endocytic pathways. This protein may enhance cell growth of certain breast tumors. This gene is part of a gene cluster on chromosome Xp11.23. A pseudogene of this gene is found on chromosome 12. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of SLC9A7. |
Description | 1bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TCCGCTGACATTCACTAATA |
PCR Primer |
Forward: AATCCAGGAGTTTGGAAGGATTTCT Reverse: ACTGCTGCATTTCTTAGTTGTTGAA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.