Online Inquiry
SLC9A3R1 Knockout Cell Line
SPL-03403
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC9A3R1 |
| Gene Abbr. | SLC9A3R1 |
| Gene ID | 9368 |
| Full Name | SLC9A3 regulator 1 |
| Alias | EBP50, NHERF, NHERF-1, NHERF1, NPHLOP2 |
| Species | Human |
| Genomic Locus | chr17:74749026 |
| Transcript | NM_004252 |
| WT Expression Level | 90.33 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a sodium/hydrogen exchanger regulatory cofactor. The protein interacts with and regulates various proteins including the cystic fibrosis transmembrane conductance regulator and G-protein coupled receptors such as the beta2-adrenergic receptor and the parathyroid hormone 1 receptor. The protein also interacts with proteins that function as linkers between integral membrane and cytoskeletal proteins. The protein localizes to actin-rich structures including membrane ruffles, microvilli, and filopodia. Mutations in this gene result in hypophosphatemic nephrolithiasis/osteoporosis type 2, and loss of heterozygosity of this gene is implicated in breast cancer.[provided by RefSeq, Sep 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of SLC9A3R1. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGAGGTGAACGGCGAAAACG |
| PCR Primer |
Forward: GTTCGCTGGACGGGAAGAA Reverse: AGCTTCTGCAGCTGCTCGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.