SLC46A3 Knockout Cell Line - CD BioSciences

service-banner

SLC46A3 Knockout Cell Line

SLC46A3 Knockout Cell Line

SPL-03378

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name SLC46A3
Gene Abbr. SLC46A3
Gene ID 283537
Full Name solute carrier family 46 member 3
Alias FKSG16
Species Human
Genomic Locus chr13:28713395
Transcript NM_001135919
WT Expression Level 3.64 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a member of a transmembrane protein family that transports small molecules across membranes. The encoded protein has been found in lysosomal membranes, where it can transport catabolites from the lysosomes to the cytoplasm. This protein has been shown to be an effective transporter of the cytotoxic drug maytansine, which is used in antibody-based targeting of cancer cells. [provided by RefSeq, Dec 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of SLC46A3.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence GCTGGTTGCAAGAGCACCAA
PCR Primer Forward: GACCACTCAAAACCTAGCTCTCTAA
Reverse: TCTGCAGATGGACATAAGTGGATTA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.