Online Inquiry
SLC46A3 Knockout Cell Line
SPL-03377
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 13bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC46A3 |
| Gene Abbr. | SLC46A3 |
| Gene ID | 283537 |
| Full Name | solute carrier family 46 member 3 |
| Alias | FKSG16 |
| Species | Human |
| Genomic Locus | chr13:28713395 |
| Transcript | NM_001135919 |
| WT Expression Level | 3.64 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of a transmembrane protein family that transports small molecules across membranes. The encoded protein has been found in lysosomal membranes, where it can transport catabolites from the lysosomes to the cytoplasm. This protein has been shown to be an effective transporter of the cytotoxic drug maytansine, which is used in antibody-based targeting of cancer cells. [provided by RefSeq, Dec 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of SLC46A3. |
| Description | 13bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTGGTTGCAAGAGCACCAA |
| PCR Primer |
Forward: GACCACTCAAAACCTAGCTCTCTAA Reverse: TCTGCAGATGGACATAAGTGGATTA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.