SLC43A2 Knockout Cell Line - CD BioSciences

service-banner

SLC43A2 Knockout Cell Line

SLC43A2 Knockout Cell Line

SPL-03372

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name SLC43A2
Gene Abbr. SLC43A2
Gene ID 124935
Full Name solute carrier family 43 member 2
Alias LAT4
Species Human
Genomic Locus chr17:1614999
Transcript NM_152346
WT Expression Level 26.53 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the L-amino acid transporter-3 or SLC43 family of transporters. The encoded protein mediates sodium-, chloride-, and pH-independent transport of L-isomers of neutral amino acids, including leucine, phenylalanine, valine and methionine. This protein may contribute to the transfer of amino acids across the placental membrane to the fetus. [provided by RefSeq, Mar 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of SLC43A2.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence TCCTGCTTGCTGATTGCGTA
PCR Primer Forward: AAGTAACTGAGTAGAGGCGTAACAG
Reverse: TCTGTCTCAAGAAAAACCAAAAACCA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.