Online Inquiry
SLC43A1 Knockout Cell Line
SPL-03371
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | SLC43A1 |
| Gene Abbr. | SLC43A1 |
| Gene ID | 8501 |
| Full Name | solute carrier family 43 member 1 |
| Alias | LAT3, PB39, POV1, R00504 |
| Species | Human |
| Genomic Locus | chr11:57501166 |
| Transcript | NM_003627 |
| WT Expression Level | 22.04 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | SLC43A1 belongs to the system L family of plasma membrane carrier proteins that transports large neutral amino acids (Babu et al., 2003 [PubMed 12930836]).[supplied by OMIM, Mar 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of SLC43A1. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTTTGGCCCCCGACCCGTG |
| PCR Primer |
Forward: CATCCCACCTATTCTTTTCTTGTGG Reverse: CCAACACCACCCAGGATGAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.