SLC43A1 Knockout Cell Line - CD BioSciences

service-banner

SLC43A1 Knockout Cell Line

SLC43A1 Knockout Cell Line

SPL-03371

Size Price
1 Unit Online Inquiry
Description
2bp insertion
Target Information
Target Name SLC43A1
Gene Abbr. SLC43A1
Gene ID 8501
Full Name solute carrier family 43 member 1
Alias LAT3, PB39, POV1, R00504
Species Human
Genomic Locus chr11:57501166
Transcript NM_003627
WT Expression Level 22.04 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction SLC43A1 belongs to the system L family of plasma membrane carrier proteins that transports large neutral amino acids (Babu et al., 2003 [PubMed 12930836]).[supplied by OMIM, Mar 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of SLC43A1.
Description 2bp insertion
Parental Cell Line C631
Guide RNA Sequence GCTTTGGCCCCCGACCCGTG
PCR Primer Forward: CATCCCACCTATTCTTTTCTTGTGG
Reverse: CCAACACCACCCAGGATGAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.