SLC39A8 Knockout Cell Line - CD BioSciences

service-banner

SLC39A8 Knockout Cell Line

SLC39A8 Knockout Cell Line

SPL-03367

Size Price
1 Unit Online Inquiry
Description
8bp deletion
Target Information
Target Name SLC39A8
Gene Abbr. SLC39A8
Gene ID 64116
Full Name solute carrier family 39 member 8
Alias BIGM103, CDG2N, LZT-Hs6, PP3105, ZIP8
Species Human
Genomic Locus chr4:102305074
Transcript NM_001135148
WT Expression Level 8.18 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the SLC39 family of solute-carrier genes, which show structural characteristics of zinc transporters. The encoded protein is glycosylated and found in the plasma membrane and mitochondria, and functions in the cellular import of zinc at the onset of inflammation. It is also thought to be the primary transporter of the toxic cation cadmium, which is found in cigarette smoke. Multiple transcript variants encoding different isoforms have been found for this gene. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Oct 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of SLC39A8.
Description 8bp deletion
Parental Cell Line C631
Guide RNA Sequence TCAACATAACTGTCGACTTT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.