Online Inquiry
SLC39A8 Knockout Cell Line
SPL-03366
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
67bp insertion |
Target Information | |
---|---|
Target Name | SLC39A8 |
Gene Abbr. | SLC39A8 |
Gene ID | 64116 |
Full Name | solute carrier family 39 member 8 |
Alias | BIGM103, CDG2N, LZT-Hs6, PP3105, ZIP8 |
Species | Human |
Genomic Locus | chr4:102307534 |
Transcript | NM_001135148 |
WT Expression Level | 8.18 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the SLC39 family of solute-carrier genes, which show structural characteristics of zinc transporters. The encoded protein is glycosylated and found in the plasma membrane and mitochondria, and functions in the cellular import of zinc at the onset of inflammation. It is also thought to be the primary transporter of the toxic cation cadmium, which is found in cigarette smoke. Multiple transcript variants encoding different isoforms have been found for this gene. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Oct 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 67bp insertion in a coding exon of SLC39A8. |
Description | 67bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | GTGGAGTCAAAATCAATCCG |
PCR Primer |
Forward: GCTGTGATTCAGCTTTCTCTTATCC Reverse: AAAACATCATTTGGTTCCTTGCTCT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.