Online Inquiry
SLC39A14 Knockout Cell Line
SPL-03361
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 56bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC39A14 |
| Gene Abbr. | SLC39A14 |
| Gene ID | 23516 |
| Full Name | solute carrier family 39 member 14 |
| Alias | HCIN, HMNDYT2, LZT-Hs4, NET34, ZIP14 |
| Species | Human |
| Genomic Locus | chr8:22404848 |
| Transcript | NM_001128431 |
| WT Expression Level | 54.78 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A14 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 56bp deletion in a coding exon of SLC39A14. |
| Description | 56bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCTAATACATCGGTATGGCG |
| PCR Primer |
Forward: AGAGACTGAGGGATAGTCTCAACA Reverse: CTTACCGTGGAGAGGTTCCTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.