Online Inquiry
SLC38A5 Knockout Cell Line
SPL-03352
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 28bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC38A5 |
| Gene Abbr. | SLC38A5 |
| Gene ID | 92745 |
| Full Name | solute carrier family 38 member 5 |
| Alias | JM24, SN2, SNAT5, pp7194 |
| Species | Human |
| Genomic Locus | chrX:48466978 |
| Transcript | NM_033518 |
| WT Expression Level | 268.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a system N sodium-coupled amino acid transporter. The encoded protein transports glutamine, asparagine, histidine, serine, alanine, and glycine across the cell membrane, but does not transport charged amino acids, imino acids, or N-alkylated amino acids. Alternative splicing results in multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Aug 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 28bp deletion in a coding exon of SLC38A5. |
| Description | 28bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTATGCCATGGCCCACACGG |
| PCR Primer |
Forward: CTCTGGGTCTCACCTGCAATAC Reverse: CTTGCTTCTTCTCTAGTCTTTCCCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.