Online Inquiry
SLC37A4 Knockout Cell Line
SPL-03347
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC37A4 |
| Gene Abbr. | SLC37A4 |
| Gene ID | 2542 |
| Full Name | solute carrier family 37 member 4 |
| Alias | G6PT1, G6PT2, G6PT3, GSD1b, GSD1c |
| Species | Human |
| Genomic Locus | chr11:119029242 |
| Transcript | NM_001467 |
| WT Expression Level | 83.31 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene regulates glucose-6-phosphate transport from the cytoplasm to the lumen of the endoplasmic reticulum, in order to maintain glucose homeostasis. It also plays a role in ATP-mediated calcium sequestration in the lumen of the endoplasmic reticulum. Mutations in this gene have been associated with various forms of glycogen storage disease. Alternative splicing in this gene results in multiple transcript variants.[provided by RefSeq, Aug 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of SLC37A4. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGGATCTCTTCCACCAATGA |
| PCR Primer |
Forward: TGGATCTCAGAGCTTCTTTATCTGG Reverse: TAGGGCCTGCTCTTTTCTACCAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.