Online Inquiry
SLC36A4 Knockout Cell Line
SPL-03344
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | SLC36A4 |
| Gene Abbr. | SLC36A4 |
| Gene ID | 120103 |
| Full Name | solute carrier family 36 member 4 |
| Alias | PAT4 |
| Species | Human |
| Genomic Locus | chr11:93165982 |
| Transcript | NM_152313 |
| WT Expression Level | 15.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | SLC36A4 belongs to the SLC36 family of amino acid transporters based on sequence similarity with other family members (e.g., SLC36A1; MIM 606561). SLC36 proteins contain about 500 amino acids and have 9 to 11 transmembrane domains. Unlike other SLC36 family members, which are proton-coupled amino acid transporters, SLC36A4 is a high-affinity/low-capacity non-proton-coupled amino acid transporter (Pillai and Meredith, 2011 [PubMed 21097500]).[supplied by OMIM, Feb 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of SLC36A4. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CACAACCTTCCAATAGTGGC |
| PCR Primer |
Forward: ACAGGTAGGCTATATAAATCATTGTGC Reverse: AACAATTGCTTTTGGCAGTGAAATC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.