Online Inquiry
SLC35A1 Knockout Cell Line
SPL-03335
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC35A1 |
| Gene Abbr. | SLC35A1 |
| Gene ID | 10559 |
| Full Name | solute carrier family 35 member A1 |
| Alias | CDG2F, CMPST, CST, hCST |
| Species | Human |
| Genomic Locus | chr6:87477482 |
| Transcript | NM_006416 |
| WT Expression Level | 17.49 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is found in the membrane of the Golgi apparatus, where it transports nucleotide sugars into the Golgi. One such nucleotide sugar is CMP-sialic acid, which is imported into the Golgi by the encoded protein and subsequently glycosylated. Defects in this gene are a cause of congenital disorder of glycosylation type 2F (CDG2F). Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of SLC35A1. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTCTGTGATACACACGGCTG |
| PCR Primer |
Forward: CACGTATTTTCCAGACAATGTCACT Reverse: ACAAATACCCTCACCAGGTAGAAAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.