Online Inquiry
SLC30A7 Knockout Cell Line
SPL-03328
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 20bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC30A7 |
| Gene Abbr. | SLC30A7 |
| Gene ID | 148867 |
| Full Name | solute carrier family 30 member 7 |
| Alias | ZNT7, ZnT-7, ZnTL2 |
| Species | Human |
| Genomic Locus | chr1:100896641 |
| Transcript | NM_133496 |
| WT Expression Level | 8.05 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Zinc functions as a cofactor for numerous enzymes, nuclear factors, and hormones and as an intra- and intercellular signal ion. Members of the zinc transporter (ZNT)/SLC30 subfamily of the cation diffusion facilitator family, such as SLC30A7, permit cellular efflux of zinc (Seve et al., 2004 [PubMed 15154973]).[supplied by OMIM, Mar 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of SLC30A7. |
| Description | 20bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGGAACTACTCTACGGCATC |
| PCR Primer |
Forward: GTGAAGAAAGGAGCATGTGAACTG Reverse: CAGAGGTAGGTAACAAAGGTAGGAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.