Online Inquiry
SLC30A10 Knockout Cell Line
SPL-03324
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | SLC30A10 |
| Gene Abbr. | SLC30A10 |
| Gene ID | 55532 |
| Full Name | solute carrier family 30 member 10 |
| Alias | HMDPC, HMNDYT1, ZNT10, ZNT8, ZRC1 |
| Species | Human |
| Genomic Locus | chr1:219927077 |
| Transcript | NM_018713 |
| WT Expression Level | 0.12 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene is highly expressed in the liver and is inducible by manganese. Its protein product appears to be critical in maintaining manganese levels, and has higher specificity for manganese than zinc. Loss of function mutations appear to result in a pleomorphic phenotype, including dystonia and adult-onset parkinsonism. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of SLC30A10. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGGCTCATTCTGGGTGTTGA |
| PCR Primer |
Forward: TCTATGCATGTAACTGGCCTACTTT Reverse: AAGGGTCTCCCTTAAGCTAGTAGAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.