Online Inquiry
SLC29A4 Knockout Cell Line
SPL-03318
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
14bp deletion |
Target Information | |
---|---|
Target Name | SLC29A4 |
Gene Abbr. | SLC29A4 |
Gene ID | 222962 |
Full Name | solute carrier family 29 member 4 |
Alias | ENT4, PMAT |
Species | Human |
Genomic Locus | chr7:5290752 |
Transcript | NM_153247 |
WT Expression Level | 8.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the SLC29A/ENT transporter protein family. The encoded membrane protein catalyzes the reuptake of monoamines into presynaptic neurons, thus determining the intensity and duration of monoamine neural signaling. It has been shown to transport several compounds, including serotonin, dopamine, and the neurotoxin 1-methyl-4-phenylpyridinium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of SLC29A4. |
Description | 14bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | ATGGCGTGATAACGGTCATC |
PCR Primer |
Forward: GATGACAGAGGTATCTGGAACAGAG Reverse: GAGATCTGAATAAAACAGGTCCCCG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.