Online Inquiry
SLC27A4 Knockout Cell Line
SPL-03315
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 43bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC27A4 |
| Gene Abbr. | SLC27A4 |
| Gene ID | 10999 |
| Full Name | solute carrier family 27 member 4 |
| Alias | ACSVL4, FATP4, IPS |
| Species | Human |
| Genomic Locus | chr9:128345393 |
| Transcript | NM_005094 |
| WT Expression Level | 23.52 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of a family of fatty acid transport proteins, which are involved in translocation of long-chain fatty acids cross the plasma membrane. This protein is expressed at high levels on the apical side of mature enterocytes in the small intestine, and appears to be the principal fatty acid transporter in enterocytes. Clinical studies suggest this gene as a candidate gene for the insulin resistance syndrome. Mutations in this gene have been associated with ichthyosis prematurity syndrome. [provided by RefSeq, Apr 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 43bp deletion in a coding exon of SLC27A4. |
| Description | 43bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAGAACCGCAATGAGTTCGT |
| PCR Primer |
Forward: CTGTGGTCTGTGTAAGATCCCAT Reverse: CCATTTTGTTTGCCTCTACCGTTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.