SLC26A2 Knockout Cell Line - CD BioSciences

service-banner

SLC26A2 Knockout Cell Line

SLC26A2 Knockout Cell Line

SPL-03311

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name SLC26A2
Gene Abbr. SLC26A2
Gene ID 1836
Full Name solute carrier family 26 member 2
Alias D5S1708, DTD, DTDST, EDM4, MST153
Species Human
Genomic Locus chr5:149977817
Transcript NM_000112
WT Expression Level 4.87 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The diastrophic dysplasia sulfate transporter is a transmembrane glycoprotein implicated in the pathogenesis of several human chondrodysplasias. It apparently is critical in cartilage for sulfation of proteoglycans and matrix organization. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of SLC26A2.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence ATTTCTCTTGACGCTCAATA
PCR Primer Forward: TAAAGAGCAACATAACGTTTCACCC
Reverse: CAATAATATGCCCACAATCAAGCCT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.