Online Inquiry
SLC25A5 Knockout Cell Line
SPL-03305
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC25A5 |
| Gene Abbr. | SLC25A5 |
| Gene ID | 292 |
| Full Name | solute carrier family 25 member 5 |
| Alias | 2F1, AAC2, ANT2, T2, T3 |
| Species | Human |
| Genomic Locus | chrX:119468583 |
| Transcript | NM_001152 |
| WT Expression Level | 1088.01 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Suppressed expression of this gene has been shown to induce apoptosis and inhibit tumor growth. The human genome contains several non-transcribed pseudogenes of this gene.[provided by RefSeq, Jun 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of SLC25A5. |
| Description | 1bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GATGGGCGCTACCGCCGTCT |
| PCR Primer |
Forward: TATATAAATCGGCCATTTGCTTCGC Reverse: AGTTTGACTTCTGTTCTGCCTCTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.