Online Inquiry
SLC25A46 Knockout Cell Line
SPL-03302
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 26bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC25A46 |
| Gene Abbr. | SLC25A46 |
| Gene ID | 91137 |
| Full Name | solute carrier family 25 member 46 |
| Alias | HMSN6B |
| Species | Human |
| Genomic Locus | chr5:110739129 |
| Transcript | NM_138773 |
| WT Expression Level | 31.54 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a mitochondrial solute carrier protein family member. It functions in promoting mitochondrial fission, and prevents the formation of hyperfilamentous mitochondria. Mutation of this gene results in neuropathy and optic atrophy. [provided by RefSeq, Aug 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 26bp deletion in a coding exon of SLC25A46. |
| Description | 26bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGGCGCCCGGACGGATTTGA |
| PCR Primer |
Forward: GACAACAAACTTTTAAGGTCCAGGT Reverse: GGATATCTGGGGGAGTCGTCA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.