Online Inquiry
SLC25A45 Knockout Cell Line
SPL-03301
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
19bp deletion |
Target Information | |
---|---|
Target Name | SLC25A45 |
Gene Abbr. | SLC25A45 |
Gene ID | 283130 |
Full Name | solute carrier family 25 member 45 |
Species | Human |
Genomic Locus | chr11:65379389 |
Transcript | NM_001077241 |
WT Expression Level | 3.01 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | SLC25A45 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]).[supplied by OMIM, Mar 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 19bp deletion in a coding exon of SLC25A45. |
Description | 19bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TTCCTAGCGGGCTGCACCGG |
PCR Primer |
Forward: GTTCTCCAGGGTCAAAGGTCTC Reverse: GCTTCTTCAAGGGAATGAGCTTC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.