SLC25A42 Knockout Cell Line - CD BioSciences

service-banner

SLC25A42 Knockout Cell Line

SLC25A42 Knockout Cell Line

SPL-03296

Size Price
1 Unit Online Inquiry
Description
482bp insertion
Target Information
Target Name SLC25A42
Gene Abbr. SLC25A42
Gene ID 284439
Full Name solute carrier family 25 member 42
Alias MECREN
Species Human
Genomic Locus chr19:19101842
Transcript NM_178526
WT Expression Level 3.27 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a solute carrier family 25 protein. Solute carrier family 25 proteins are localized to mitochondria and play critical roles in the transport of molecules across the inner mitochondrial membrane. The encoded protein is a mitochondrial transporter for coenzyme A (CoA) and adenosine 3',5'-diphosphate. [provided by RefSeq, Feb 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 482bp insertion in a coding exon of SLC25A42.
Description 482bp insertion
Parental Cell Line C631
Guide RNA Sequence CAGGGGAGCTACCGCTGTTT
PCR Primer Forward: CAACATACTCAGGGTGGGGTACATC
Reverse: AAATAAAAGCCAATTTGAAGCGTGG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.