Online Inquiry
SLC25A29 Knockout Cell Line
SPL-03275
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp insertion |
| Target Information | |
|---|---|
| Target Name | SLC25A29 |
| Gene Abbr. | SLC25A29 |
| Gene ID | 123096 |
| Full Name | solute carrier family 25 member 29 |
| Alias | C14orf69, CACL, ORNT3 |
| Species | Human |
| Genomic Locus | chr14:100292972 |
| Transcript | NM_001039355 |
| WT Expression Level | 16.16 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a nuclear-encoded mitochondrial protein that is a member of the large family of solute carrier family 25 (SLC25) mitochondrial transporters. The members of this superfamily are involved in numerous metabolic pathways and cell functions. This gene product was previously reported to be a mitochondrial carnitine-acylcarnitine-like (CACL) translocase (PMID:128829710) or an ornithine transporter (designated ORNT3, PMID:19287344), however, a recent study characterized the main role of this protein as a mitochondrial transporter of basic amino acids, with a preference for arginine and lysine (PMID:24652292). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp insertion in a coding exon of SLC25A29. |
| Description | 5bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTCACCTTCATCAACGCGC |
| PCR Primer |
Forward: AGTCCAGCGAGCCCTTGTAG Reverse: ACCTAGGTTCTAACGAAATTCTGCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.