SLC25A25 Knockout Cell Line - CD BioSciences

service-banner

SLC25A25 Knockout Cell Line

SLC25A25 Knockout Cell Line

SPL-03274

Size Price
1 Unit Online Inquiry
Description
4bp deletion
Target Information
Target Name SLC25A25
Gene Abbr. SLC25A25
Gene ID 114789
Full Name solute carrier family 25 member 25
Alias MCSC, PCSCL, SCAMC-2
Species Human
Genomic Locus chr9:128101331
Transcript NM_001006641
WT Expression Level 9.26 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene belongs to the family of calcium-binding mitochondrial carriers, with a characteristic mitochondrial carrier domain at the C-terminus. These proteins are found in the inner membranes of mitochondria, and function as transport proteins. They shuttle metabolites, nucleotides and cofactors through the mitochondrial membrane and thereby connect and/or regulate cytoplasm and matrix functions. This protein may function as an ATP-Mg/Pi carrier that mediates the transport of Mg-ATP in exchange for phosphate, and likely responsible for the net uptake or efflux of adenine nucleotides into or from the mitochondria. Alternatively spliced transcript variants encoding different isoforms with a common C-terminus but variable N-termini have been described for this gene. [provided by RefSeq, Jul 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of SLC25A25.
Description 4bp deletion
Parental Cell Line C631
Guide RNA Sequence CATGCAGTCCCTGCGGGACT
PCR Primer Forward: GGCAGCTAGACTTTGAAGAATTTGT
Reverse: ATTCATCCTTTCAAACCACGAGAAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.