SLC25A22 Knockout Cell Line - CD BioSciences

service-banner

SLC25A22 Knockout Cell Line

SLC25A22 Knockout Cell Line

SPL-03272

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name SLC25A22
Gene Abbr. SLC25A22
Gene ID 79751
Full Name solute carrier family 25 member 22
Alias DEE3, EIEE3, GC-1, GC1, NET44
Species Human
Genomic Locus chr11:794868
Transcript NM_001191060
WT Expression Level 26.31 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a mitochondrial glutamate carrier. Mutations in this gene are associated with early infantile epileptic encephalopathy. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jul 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of SLC25A22.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence TCATCAATGGCGGCATCGCC
PCR Primer Forward: TTTCCCTTCTGTCAAACAGGGTG
Reverse: GTGCAATCGAGTTAAATGGCTGATA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.