Online Inquiry
SLC25A20 Knockout Cell Line
SPL-03270
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 22bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC25A20 |
| Gene Abbr. | SLC25A20 |
| Gene ID | 788 |
| Full Name | solute carrier family 25 member 20 |
| Alias | CAC, CACT |
| Species | Human |
| Genomic Locus | chr3:48898704 |
| Transcript | NM_000387 |
| WT Expression Level | 20.26 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene product is one of several closely related mitochondrial-membrane carrier proteins that shuttle substrates between cytosol and the intramitochondrial matrix space. This protein mediates the transport of acylcarnitines into mitochondrial matrix for their oxidation by the mitochondrial fatty acid-oxidation pathway. Mutations in this gene are associated with carnitine-acylcarnitine translocase deficiency, which can cause a variety of pathological conditions such as hypoglycemia, cardiac arrest, hepatomegaly, hepatic dysfunction and muscle weakness, and is usually lethal in new born and infants. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of SLC25A20. |
| Description | 22bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAGGGTGACCGACGAACACC |
| PCR Primer |
Forward: CCTGAAAGAGAGATTCCCTAGACTT Reverse: GAACTGACAGACGGAGTGACAGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.