Online Inquiry
SLC25A17 Knockout Cell Line
SPL-03266
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC25A17 |
| Gene Abbr. | SLC25A17 |
| Gene ID | 10478 |
| Full Name | solute carrier family 25 member 17 |
| Alias | PMP34 |
| Species | Human |
| Genomic Locus | chr22:40779093 |
| Transcript | NM_006358 |
| WT Expression Level | 62.01 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a peroxisomal membrane protein that belongs to the family of mitochondrial solute carriers. It is expressed in the liver, and is likely involved in transport. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of SLC25A17. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTTGCTAACAACTCCACTCT |
| PCR Primer |
Forward: TGTGGCAACATATTCCAGATACAAA Reverse: CTTCTAACAGTAGTGGCTTGTGTTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.