Online Inquiry
SLC25A15 Knockout Cell Line
SPL-03263
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC25A15 |
| Gene Abbr. | SLC25A15 |
| Gene ID | 10166 |
| Full Name | solute carrier family 25 member 15 |
| Alias | D13S327, HHH, LNC-HC, ORC1, ORNT1 |
| Species | Human |
| Genomic Locus | chr13:40793229 |
| Transcript | NM_014252 |
| WT Expression Level | 35.42 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene is a member of the mitochondrial carrier family. The encoded protein transports ornithine across the inner mitochondrial membrane from the cytosol to the mitochondrial matrix. The protein is an essential component of the urea cycle, and functions in ammonium detoxification and biosynthesis of the amino acid arginine. Mutations in this gene result in hyperornithinemia-hyperammonemia-homocitrullinuria (HHH) syndrome. There is a pseudogene of this locus on the Y chromosome.[provided by RefSeq, May 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of SLC25A15. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAAATCCAATCCTGCTATCC |
| PCR Primer |
Forward: TTTTGATCTGTGAGCTTTCTAGGAG Reverse: TGGTAGTATAATCTCATGGGACCAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.