SLC25A15 Knockout Cell Line - CD BioSciences

service-banner

SLC25A15 Knockout Cell Line

SLC25A15 Knockout Cell Line

SPL-03262

Size Price
1 Unit Online Inquiry
Description
19bp deletion
Target Information
Target Name SLC25A15
Gene Abbr. SLC25A15
Gene ID 10166
Full Name solute carrier family 25 member 15
Alias D13S327, HHH, LNC-HC, ORC1, ORNT1
Species Human
Genomic Locus chr13:40793229
Transcript NM_014252
WT Expression Level 35.42 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene is a member of the mitochondrial carrier family. The encoded protein transports ornithine across the inner mitochondrial membrane from the cytosol to the mitochondrial matrix. The protein is an essential component of the urea cycle, and functions in ammonium detoxification and biosynthesis of the amino acid arginine. Mutations in this gene result in hyperornithinemia-hyperammonemia-homocitrullinuria (HHH) syndrome. There is a pseudogene of this locus on the Y chromosome.[provided by RefSeq, May 2009].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 19bp deletion in a coding exon of SLC25A15.
Description 19bp deletion
Parental Cell Line C631
Guide RNA Sequence GAAATCCAATCCTGCTATCC
PCR Primer Forward: TTTTGATCTGTGAGCTTTCTAGGAG
Reverse: TGGTAGTATAATCTCATGGGACCAC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.