Online Inquiry
SLC25A14 Knockout Cell Line
SPL-03260
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 20bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC25A14 |
| Gene Abbr. | SLC25A14 |
| Gene ID | 9016 |
| Full Name | solute carrier family 25 member 14 |
| Alias | BMCP1, UCP5 |
| Species | Human |
| Genomic Locus | chrX:130345244 |
| Transcript | NM_001282195 |
| WT Expression Level | 20.96 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). Uncoupling proteins separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. Uncoupling proteins facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. This gene is widely expressed in many tissues with the greatest abundance in brain and testis. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 4. [provided by RefSeq, Aug 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of SLC25A14. |
| Description | 20bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGGCGGCCTTGCCTCTATCG |
| PCR Primer |
Forward: CTTGGTGGGGTTTTTCTTCTACATC Reverse: TTAACTCATCTGCCATACCATCAGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.