Online Inquiry
SLC25A13 Knockout Cell Line
SPL-03259
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | SLC25A13 |
| Gene Abbr. | SLC25A13 |
| Gene ID | 10165 |
| Full Name | solute carrier family 25 member 13 |
| Alias | ARALAR2, CITRIN, CTLN2, NICCD |
| Species | Human |
| Genomic Locus | chr7:96277276 |
| Transcript | NM_014251 |
| WT Expression Level | 34.15 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of SLC25A13. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTATCGAGTGACAAAGTCAT |
| PCR Primer |
Forward: TTGAACTGTTGGGAGATAATGGTCA Reverse: TGGTCATTAGAGCAAAAGAAAGCTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.