Online Inquiry
SLC25A10 Knockout Cell Line
SPL-03253
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 26bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC25A10 |
| Gene Abbr. | SLC25A10 |
| Gene ID | 1468 |
| Full Name | solute carrier family 25 member 10 |
| Alias | DIC, MTDPS19 |
| Species | Human |
| Genomic Locus | chr17:81715004 |
| Transcript | NM_012140 |
| WT Expression Level | 19.20 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of a family of proteins that translocate small metabolites across the mitochondrial membrane. The encoded protein exchanges dicarboxylates, such as malate and succinate, for phosphate, sulfate, and other small molecules, thereby providing substrates for metabolic processes including the Krebs cycle and fatty acid synthesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 26bp deletion in a coding exon of SLC25A10. |
| Description | 26bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTGCGGGTGGTGCGTACCGA |
| PCR Primer |
Forward: CTTCCTTGCACAAAGTCTTGAAAAG Reverse: GTTTCCCCCTCTCTGGATGAAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.