Online Inquiry
SLC22A5 Knockout Cell Line
SPL-03249
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 34bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC22A5 |
| Gene Abbr. | SLC22A5 |
| Gene ID | 6584 |
| Full Name | solute carrier family 22 member 5 |
| Alias | CDSP, OCTN2 |
| Species | Human |
| Genomic Locus | chr5:132370089 |
| Transcript | NM_003060 |
| WT Expression Level | 12.93 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is a plasma integral membrane protein which functions both as an organic cation transporter and as a sodium-dependent high affinity carnitine transporter. The encoded protein is involved in the active cellular uptake of carnitine. Mutations in this gene are the cause of systemic primary carnitine deficiency (CDSP), an autosomal recessive disorder manifested early in life by hypoketotic hypoglycemia and acute metabolic decompensation, and later in life by skeletal myopathy or cardiomyopathy. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 34bp deletion in a coding exon of SLC22A5. |
| Description | 34bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGTGTTCCTGATAGCGACCC |
| PCR Primer |
Forward: GGCATGCGGGACTACGAC Reverse: CTTCCTGGTACCCTCTTCAAAGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.