Online Inquiry
SLC22A18 Knockout Cell Line
SPL-03247
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
190bp insertion |
Target Information | |
---|---|
Target Name | SLC22A18 |
Gene Abbr. | SLC22A18 |
Gene ID | 5002 |
Full Name | solute carrier family 22 member 18 |
Alias | BWR1A, BWSCR1A, HET, IMPT1, ITM |
Species | Human |
Genomic Locus | chr11:2908305 |
Transcript | NM_002555 |
WT Expression Level | 1.44 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. This gene is imprinted, with preferential expression from the maternal allele. Mutations in this gene have been found in Wilms' tumor and lung cancer. This protein may act as a transporter of organic cations, and have a role in the transport of chloroquine and quinidine-related compounds in kidney. Several alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Oct 2015]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 190bp insertion in a coding exon of SLC22A18. |
Description | 190bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | CTGCTGGGCGGGCCGGTATT |
PCR Primer |
Forward: GATTCTAGGCCCTGCAGTCTTTC Reverse: GTTCACCAGTCACACTCTCTCTC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.