Online Inquiry
SLC20A2 Knockout Cell Line
SPL-03243
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 22bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC20A2 |
| Gene Abbr. | SLC20A2 |
| Gene ID | 6575 |
| Full Name | solute carrier family 20 member 2 |
| Alias | GLVR-2, GLVR2, IBGC1, IBGC2, IBGC3 |
| Species | Human |
| Genomic Locus | chr8:42472144 |
| Transcript | NM_001257181 |
| WT Expression Level | 20.99 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the inorganic phosphate transporter family. The encoded protein is a type 3 sodium-dependent phosphate symporter that plays an important role in phosphate homeostasis by mediating cellular phosphate uptake. The encoded protein also confers susceptibility to viral infection as a gamma-retroviral receptor. Mutations in this gene may play a role in familial idiopathic basal ganglia calcification. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of SLC20A2. |
| Description | 22bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGTGAACCTGTACAACGAGA |
| PCR Primer |
Forward: TGTGAAACATCCAACCAGTTTTTGA Reverse: CATCATAGCTTTCATCTTGGCCTTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.