Online Inquiry
SLC18A2 Knockout Cell Line
SPL-03235
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 14bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC18A2 |
| Gene Abbr. | SLC18A2 |
| Gene ID | 6571 |
| Full Name | solute carrier family 18 member A2 |
| Alias | PKDYS2, SVAT, SVMT, VAT2, VMAT2 |
| Species | Human |
| Genomic Locus | chr10:117244089 |
| Transcript | NM_003054 |
| WT Expression Level | 0.56 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The vesicular monoamine transporter acts to accumulate cytosolic monoamines into synaptic vesicles, using the proton gradient maintained across the synaptic vesicular membrane. Its proper function is essential to the correct activity of the monoaminergic systems that have been implicated in several human neuropsychiatric disorders. The transporter is a site of action of important drugs, including reserpine and tetrabenazine (summary by Peter et al., 1993 [PubMed 7905859]). See also SLC18A1 (MIM 193002).[supplied by OMIM, Jan 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of SLC18A2. |
| Description | 14bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTATTATGATAACTCGACTA |
| PCR Primer |
Forward: CATTCTGCTCTTATCCCCAGTCC Reverse: CCTGTTGGTCAGTAGTCCTATGAAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.