SLC17A9 Knockout Cell Line - CD BioSciences

service-banner

SLC17A9 Knockout Cell Line

SLC17A9 Knockout Cell Line

SPL-03233

Size Price
1 Unit Online Inquiry
Description
22bp deletion
Target Information
Target Name SLC17A9
Gene Abbr. SLC17A9
Gene ID 63910
Full Name solute carrier family 17 member 9
Alias C20orf59, POROK8, VNUT
Species Human
Genomic Locus chr20:62957491
Transcript NM_022082
WT Expression Level 13.02 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of a family of transmembrane proteins that are involved in the transport of small molecules. The encoded protein participates in the vesicular uptake, storage, and secretion of adenoside triphosphate (ATP) and other nucleotides. A mutation in this gene was found in individuals with autosomal dominant disseminated superficial actinic porokeratosis-8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of SLC17A9.
Description 22bp deletion
Parental Cell Line C631
Guide RNA Sequence CAGTGGGGTGACGGCCGTGA
PCR Primer Forward: GCTCTGAGCACCCACTCAAG
Reverse: ACACTTGTACACCACCTGCAT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.