Online Inquiry
SLC17A9 Knockout Cell Line
SPL-03233
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 22bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC17A9 |
| Gene Abbr. | SLC17A9 |
| Gene ID | 63910 |
| Full Name | solute carrier family 17 member 9 |
| Alias | C20orf59, POROK8, VNUT |
| Species | Human |
| Genomic Locus | chr20:62957491 |
| Transcript | NM_022082 |
| WT Expression Level | 13.02 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of a family of transmembrane proteins that are involved in the transport of small molecules. The encoded protein participates in the vesicular uptake, storage, and secretion of adenoside triphosphate (ATP) and other nucleotides. A mutation in this gene was found in individuals with autosomal dominant disseminated superficial actinic porokeratosis-8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of SLC17A9. |
| Description | 22bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CAGTGGGGTGACGGCCGTGA |
| PCR Primer |
Forward: GCTCTGAGCACCCACTCAAG Reverse: ACACTTGTACACCACCTGCAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.