Online Inquiry
SLC16A3 Knockout Cell Line
SPL-03229
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 19bp deletion |
| Target Information | |
|---|---|
| Target Name | SLC16A3 |
| Gene Abbr. | SLC16A3 |
| Gene ID | 9123 |
| Full Name | solute carrier family 16 member 3 |
| Alias | MCT 3, MCT 4, MCT-3, MCT-4, MCT3 |
| Species | Human |
| Genomic Locus | chr17:82236205 |
| Transcript | NM_004207 |
| WT Expression Level | 64.80 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Lactic acid and pyruvate transport across plasma membranes is catalyzed by members of the proton-linked monocarboxylate transporter (MCT) family, which has been designated solute carrier family-16. Each MCT appears to have slightly different substrate and inhibitor specificities and transport kinetics, which are related to the metabolic requirements of the tissues in which it is found. The MCTs, which include MCT1 (SLC16A1; MIM 600682) and MCT2 (SLC16A7; MIM 603654), are characterized by 12 predicted transmembrane domains (Price et al., 1998 [PubMed 9425115]).[supplied by OMIM, Mar 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 19bp deletion in a coding exon of SLC16A3. |
| Description | 19bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCCTGCTGGCCATGCTCTAC |
| PCR Primer |
Forward: CTGTCCTCTGAGACGGTCTATAAAT Reverse: TCTTCGGCTGTTTCGTCATCA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.