SLC16A10 Knockout Cell Line - CD BioSciences

service-banner

SLC16A10 Knockout Cell Line

SLC16A10 Knockout Cell Line

SPL-03226

Size Price
1 Unit Online Inquiry
Description
5bp deletion
Target Information
Target Name SLC16A10
Gene Abbr. SLC16A10
Gene ID 117247
Full Name solute carrier family 16 member 10
Alias MCT10, PRO0813, TAT1
Species Human
Genomic Locus chr6:111172772
Transcript NM_018593
WT Expression Level 29.65 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction SLC16A10 is a member of a family of plasma membrane amino acid transporters that mediate the Na(+)-independent transport of aromatic amino acids across the plasma membrane.[supplied by OMIM, Apr 2004].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of SLC16A10.
Description 5bp deletion
Parental Cell Line C631
Guide RNA Sequence TGTCGGAAAACAGCTGTCGT
PCR Primer Forward: AATTTCCATGGCAAAAGAACTAAGC
Reverse: ATGAAAAGGAGGATCTTTGCTTGTA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.