Online Inquiry
SLC12A5 Knockout Cell Line
SPL-03219
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp insertion |
| Target Information | |
|---|---|
| Target Name | SLC12A5 |
| Gene Abbr. | SLC12A5 |
| Gene ID | 57468 |
| Full Name | solute carrier family 12 member 5 |
| Alias | DEE34, EIEE34, EIG14, KCC2, hKCC2 |
| Species | Human |
| Genomic Locus | chr20:46035782 |
| Transcript | NM_001134771 |
| WT Expression Level | 4.42 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp insertion in a coding exon of SLC12A5. |
| Description | 10bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCATGAAGGTGCCCATGCGT |
| PCR Primer |
Forward: GAAGAGGGATGAAGGGTTGAGAATA Reverse: AGTGGTTCCTATAAAAAGCTCAGGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.