SLC11A2 Knockout Cell Line - CD BioSciences

service-banner

SLC11A2 Knockout Cell Line

SLC11A2 Knockout Cell Line

SPL-03215

Size Price
1 Unit Online Inquiry
Description
17bp deletion
Target Information
Target Name SLC11A2
Gene Abbr. SLC11A2
Gene ID 4891
Full Name solute carrier family 11 member 2
Alias AHMIO1, DCT1, DMT1, NRAMP2
Species Human
Genomic Locus chr12:51004841
Transcript NM_001174127
WT Expression Level 42.87 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the solute carrier family 11 protein family. The product of this gene transports divalent metals and is involved in iron absorption. Mutations in this gene are associated with hypochromic microcytic anemia with iron overload. A related solute carrier family 11 protein gene is located on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 17bp deletion in a coding exon of SLC11A2.
Description 17bp deletion
Parental Cell Line C631
Guide RNA Sequence CCAGTCTAGCTGCAAGCCGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.