Online Inquiry
SLC11A2 Knockout Cell Line
SPL-03215
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
17bp deletion |
Target Information | |
---|---|
Target Name | SLC11A2 |
Gene Abbr. | SLC11A2 |
Gene ID | 4891 |
Full Name | solute carrier family 11 member 2 |
Alias | AHMIO1, DCT1, DMT1, NRAMP2 |
Species | Human |
Genomic Locus | chr12:51004841 |
Transcript | NM_001174127 |
WT Expression Level | 42.87 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the solute carrier family 11 protein family. The product of this gene transports divalent metals and is involved in iron absorption. Mutations in this gene are associated with hypochromic microcytic anemia with iron overload. A related solute carrier family 11 protein gene is located on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2010]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 17bp deletion in a coding exon of SLC11A2. |
Description | 17bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CCAGTCTAGCTGCAAGCCGC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.