Sla cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Sla cDNA ORF Clone, Mouse, untagged

Sla cDNA ORF Clone, Mouse, untagged

SPD-13779

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse src-like adaptor.
Target Information
Species Mouse
Target Name SLA
Gene Abbr. Sla
Gene ID 20491
Full Name src-like adaptor
Alias Sl, Slap, Slap-1
Product Details
Description Full length Clone DNA of Mouse src-like adaptor.
NCBI Ref Seq XM_006520668.1
RefSeq ORF Size 522 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.