SIRT7 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

SIRT7 cDNA ORF Clone, Human, untagged

SIRT7 cDNA ORF Clone, Human, untagged

SPD-13759

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human sirtuin 7.
Target Information
Species Human
Target Name SirT7
Gene Abbr. SIRT7
Gene ID 51547
Full Name sirtuin 7
Alias SIR2L7
Introduction The Silent Information Regulator (SIR2) family of genes is a highly conserved group of genes that encode nicotinamide adenine dinucleotide (NAD)-dependent protein deacetylases, also known as Class III histone deacetylases. The first discovered and best characterized of these genes is Saccharomyces cerevisiae Sir2, which is involved in silencing of mating type loci, telomere maintenance, DNA damage response, and cell aging. SirT7, a mammalian homolog of Sir2, is localized primarily in the nucleolus and is most prominently expressed in hematopoietic cells, especially myeloid progenitor cells. SirT7 is recruited to chromatin by sequence-specific DNA binding transcription factors such as Elk-4, where it functions to deacetylate Lys18 of histone H3 at gene promoters and facilitate transcriptional repression. Interestingly, overexpression of SirT7 induces a global decrease in histone H3 Lys18 acetylation levels, a phenotype that has been associated with poor prognosis in prostate, lung, kidney, and pancreatic cancers in the research literature. Furthermore, studies have also shown that SirT7 is required for the maintenance of several transformed phenotypes of cancer cells, including anchorage-independent cell growth, growth in low serum conditions, and tumor formation in xenograft assays. SirT7 is also required for the E1A-induced decrease in histone H3 Lys18 acetylation, induction of cell-cycle entry, and escape from contact inhibition. Taken together, these findings strongly suggest that SirT7 is an important regulator of cellular transformation. Research has shown that the SirT7 gene is located on chromosome 17q25.3, a region that is frequently altered in acute leukemia and lymphoma and SirT7 overexpression and amplification have been detected in multiple types of cancer.
Product Details
Description Full length Clone DNA of Human sirtuin 7.
NCBI Ref Seq BC017305
RefSeq ORF Size 1203 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.