Online Inquiry
SIRT7 cDNA ORF Clone, Human, N-FLAG tag
SPD-13755
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human sirtuin 7 with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | SirT7 |
Gene Abbr. | SIRT7 |
Gene ID | 51547 |
Full Name | sirtuin 7 |
Alias | SIR2L7 |
Introduction | The Silent Information Regulator (SIR2) family of genes is a highly conserved group of genes that encode nicotinamide adenine dinucleotide (NAD)-dependent protein deacetylases, also known as Class III histone deacetylases. The first discovered and best characterized of these genes is Saccharomyces cerevisiae Sir2, which is involved in silencing of mating type loci, telomere maintenance, DNA damage response, and cell aging. SirT7, a mammalian homolog of Sir2, is localized primarily in the nucleolus and is most prominently expressed in hematopoietic cells, especially myeloid progenitor cells. SirT7 is recruited to chromatin by sequence-specific DNA binding transcription factors such as Elk-4, where it functions to deacetylate Lys18 of histone H3 at gene promoters and facilitate transcriptional repression. Interestingly, overexpression of SirT7 induces a global decrease in histone H3 Lys18 acetylation levels, a phenotype that has been associated with poor prognosis in prostate, lung, kidney, and pancreatic cancers in the research literature. Furthermore, studies have also shown that SirT7 is required for the maintenance of several transformed phenotypes of cancer cells, including anchorage-independent cell growth, growth in low serum conditions, and tumor formation in xenograft assays. SirT7 is also required for the E1A-induced decrease in histone H3 Lys18 acetylation, induction of cell-cycle entry, and escape from contact inhibition. Taken together, these findings strongly suggest that SirT7 is an important regulator of cellular transformation. Research has shown that the SirT7 gene is located on chromosome 17q25.3, a region that is frequently altered in acute leukemia and lymphoma and SirT7 overexpression and amplification have been detected in multiple types of cancer. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human sirtuin 7 with N terminal Flag tag. |
NCBI Ref Seq | BC017305 |
RefSeq ORF Size | 1242 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 1.24kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.