Online Inquiry
SIRT6 Knockout Cell Line
SPL-03211
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp insertion |
| Target Information | |
|---|---|
| Target Name | SirT6 |
| Gene Abbr. | SIRT6 |
| Gene ID | 51548 |
| Full Name | sirtuin 6 |
| Alias | SIR2L6 |
| Species | Human |
| Genomic Locus | chr19:4182496 |
| Transcript | NM_016539 |
| WT Expression Level | 10.64 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the sirtuin family of NAD-dependent enzymes that are implicated in cellular stress resistance, genomic stability, aging and energy homeostasis. The encoded protein is localized to the nucleus, exhibits ADP-ribosyl transferase and histone deacetylase activities, and plays a role in DNA repair, maintenance of telomeric chromatin, inflammation, lipid and glucose metabolism. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp insertion in a coding exon of SIRT6. |
| Description | 4bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTGTCGCCGTACGCGGACAA |
| PCR Primer |
Forward: CTCAGTGCCCCCTGATATTCC Reverse: GCTTCCTTCTGACAGCAGATAACA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.