Online Inquiry
SIRT6 cDNA ORF Clone, Human, N-Myc tag
SPD-13747
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human sirtuin 6 with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | SirT6 |
| Gene Abbr. | SIRT6 |
| Gene ID | 51548 |
| Full Name | sirtuin 6 |
| Alias | SIR2L6 |
| Introduction | The Silent Information Regulator (Sir2) family of genes is a highly conserved group of genes that encode nicotinamide adenine dinucleotide (NAD)-dependent protein deacetylases, also known as class III histone deacetylases. The first discovered and best characterized of this family is Saccharomyces cerevisiae Sir2, which is involved in silencing of mating type loci, telomere maintenance, DNA damage response, and cell aging. SirT6, a mammalian homolog of Sir2, is a nuclear, chromatin-associated protein that promotes the normal maintenance of genome integrity mediated by the base excision repair (BER) pathway. The BER pathway repairs single-stranded DNA lesions that arise spontaneously from endogenous alkylation, oxidation, and deamination events. SirT6 deficient mice show increased sensitivity to DNA-damaging agents, including the alkylating agents MMS and H2O2. In addition, these mice show genome instability with increased frequency of fragmented chromosomes, detached centromeres, and gaps. SirT6 may regulate the BER pathway by deacetylating DNA Polβ or other core components of the pathway. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human sirtuin 6 with N terminal Myc tag. |
| NCBI Ref Seq | BC005026 |
| RefSeq ORF Size | 1068 bp |
| Vector | pCMV3-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.