SIRT6 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

SIRT6 cDNA ORF Clone, Human, N-HA tag

SIRT6 cDNA ORF Clone, Human, N-HA tag

SPD-13748

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human sirtuin 6 with N terminal HA tag.
Target Information
Species Human
Target Name SirT6
Gene Abbr. SIRT6
Gene ID 51548
Full Name sirtuin 6
Alias SIR2L6
Introduction The Silent Information Regulator (Sir2) family of genes is a highly conserved group of genes that encode nicotinamide adenine dinucleotide (NAD)-dependent protein deacetylases, also known as class III histone deacetylases. The first discovered and best characterized of this family is Saccharomyces cerevisiae Sir2, which is involved in silencing of mating type loci, telomere maintenance, DNA damage response, and cell aging. SirT6, a mammalian homolog of Sir2, is a nuclear, chromatin-associated protein that promotes the normal maintenance of genome integrity mediated by the base excision repair (BER) pathway. The BER pathway repairs single-stranded DNA lesions that arise spontaneously from endogenous alkylation, oxidation, and deamination events. SirT6 deficient mice show increased sensitivity to DNA-damaging agents, including the alkylating agents MMS and H2O2. In addition, these mice show genome instability with increased frequency of fragmented chromosomes, detached centromeres, and gaps. SirT6 may regulate the BER pathway by deacetylating DNA Polβ or other core components of the pathway.
Product Details
Description Full length Clone DNA of Human sirtuin 6 with N terminal HA tag.
NCBI Ref Seq BC005026
RefSeq ORF Size 1110 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 1.11kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.