Online Inquiry
Sirt5 cDNA ORF Clone, Rat, N-Myc tag
SPD-13723
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat sirtuin 5 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | SirT5 |
Gene Abbr. | Sirt5 |
Gene ID | 306840 |
Full Name | sirtuin 5 |
Introduction | The Silent Information Regulator (SIR2) family of genes is a highly conserved group of genes that encode nicotinamide adenine dinucleotide (NAD)-dependent protein deacetylases, also known as Class III histone deacetylases. The first discovered and best characterized of these genes is Saccharomyces cerevisiae Sir2, which is involved in silencing of mating type loci, telomere maintenance, DNA damage response, and cell aging. SirT5, a mammalian homolog of Sir2, is localized to the mitochondria and has been implicated in the regulation of cell metabolism. SirT5 deacetylates carbamoyl phosphate synthetase 1 (CPS1) in the mitochondrial matrix and increases its activity in response to fasting, allowing for adaptation to increased amino acid catabolism. SirT5 has also been shown to deacetylate cytochrome c in the mitochondrial intermembrane space. In addition to its deacetylase activity, SirT5 contains lysine desuccinylase and demalonylase activity. Succinyl-lysine and malonyl-lysine modifications occur in a variety of organisms and these post-translational modifications are found on many metabolic enzymes. Like phosphorylation of serine, threonine, and tyrosine residues, lysine succinylation and malonylation induces a change of two negative charges from a +1 to a -1 charge at physiological pH, and are thought to serve similar functions in the regulation of protein activity, protein-protein interactions, and protein stability. SirT5 knockout mice show increased levels of succinyl-lysine and malonyl-lysine protein modifications in the liver, including increased succinylation of CPS1, a known target of SirT5, suggesting that SirT5 functions to regulate metabolic enzymes through its deacetylase, desuccinylase, and demalonylase activities. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat sirtuin 5 with N terminal Myc tag. |
NCBI Ref Seq | NM_001004256.1 |
RefSeq ORF Size | 933 bp |
Vector | pCMV3-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.